000100100001010110000111000100110101001111001011011110001010001111101000010

A n d r e w     A d a m s

GCCGGCCCTGCGGCTGGACGAACGGTGCGTTCAATTCTATATGCAACGACCTTCAGATACTTCCAGGCTGCTCGT

Bioinformatics Assignments/Projects

A selection of homework assignments from bioinformatics-related courses.

Bulk RNA-seq
Single-cell RNA-seq with Seurat
   From BMI 5730 - Introduction to Bioinformatics (Ohio State University, Fall 2025)

Single-cell RNA-seq with Seurat
   From BMI 7235 - Machine Learning for Bioinformatics (Ohio State University, Spring 2026)

Skills: R, RNA-seq, scRNA-seq, Seurat, PCA/UMAP, NGS data processing, differential expression, functional enrichment

Algorithmic Puzzle Solver

Try your hand at the classic "Lights Out" puzzle, then see the performance of several search algorithms in solving it!

All puzzles are randomly generated. Each algorithm displays its move-by-move solution, as well as data on its performance, including search steps taken and time for completion. Some puzzles can be solved in under a tenth of a second!

Skills: Python, PyScript, search algorithms (DFS, BFS, A*), JavaScript, HTML, CSS

Shiny App for Statistical Analysis

An interactive app for performing basic statistical analysis of data sets. View summary statistics and generate plots and regression analysis, and save custom plots into a downloadable package.

Although I have some past experience with R, this was my first time using Shiny, a package for building R-based web applications. This a simple toy application intended to teach myself Shiny, and as such has limited functionality.

Skills: R, Shiny, HTML, CSS, data analysis, statistics

Retro JavaScript Game

Aghhh! You're being attacked by monsters! Satiate them with cookies before they can get to you! But be careful: you only have so many cookies, and if you run out, you'll have to wait for your oven to bake more.

See how long you can last against the monsters (and try to get a High Score!) in this JavaScript-based game styled after classic arcade favorites.

Skills: JavaScript, HTML, PHP, CSS, SQL/MariaDB

Online Bookstore: An ASP.NET MVC Web Application

A basic ASP.NET web application simulating an online shopping experience. Written in C#/ASP.NET and using an MVC design pattern, the application allows users to browse a small selection of books, adding them to a shopping cart until the user is ready to check out. A search function allows the user to search for books by title and genre.

User account creation and authorization is handled using the ASP.NET Core API. Users can browse and add titles to their shopping cart without being logged in, but creating an account and logging in is required to check out and place an order.

Find the full application code on my GitHub.

Skills: C#/ASP.NET, MVC (with repository design pattern), Entity Framework, ORM, HTML/Razor, HTTP methods, CRUD operations, database operations

iPhone App: Food for Thought

An interactive iOS mobile application designed to help users follow the practice of mindful eating, Food for Thought was collaboratively developed by a four-person team as part of a semester-long software engineering project. The project evolved in response to the needs of a real-life dietitian acting as our client, and spanned the full life cycle of development, from conceptualization to final product delivery.

Visit our project GitHub repository here to view the full application code.

Skills: Swift, XCode, MVC, mobile app development, GitHub, Agile development

Embedded Software: Blinking Light Game

A memory game based on blinking lights, like the classic Simon game!

Developed on Wokwi.com, this game uses simulated hardware, including an ESP32 DevKit V1 board with connected peripherals (push-buttons, LEDs, and speaker). Game logic is implemented using common FreeRTOS API calls, to illustrate an understanding of basic embedded software concepts, such as tasks, interrupts, timers, and semaphores.

Skills: C/C++, FreeRTOS, embedded software