001101110001100111001100011000100111011100100001101110100000111111110110110

A n d r e w     A d a m s

TTGAATCGTCGAAGAGCTGCGTCTGGGAATGAAGTGGCATTGTCATGCAAAAATGCTGAAAAAGCGAATGAATGT

Full-stack web and software development. Machine learning.



I am a master's student in Biomedical Informatics, with a wealth of experience in computer science and biology. Through my academic courses, co-op job placements, and personal projects, I have gained experience with many tools and concepts, including:


Computer science
  • Python, R, Shiny, C++, C#, SQL
  • HTML, CSS, JavaScript, PHP
  • Linux and Windows, including command line and shell scripting
  • Web application development, embedded software
  • Git version control

Bioinformatics
  • Sequence databases/aligners, genome browsers
  • GATK, Bioconductor (DESeq2, clusterProfiler), Seurat
  • RNA-Seq (bulk and single cell), differential expression, functional enrichment
  • Data normalization, dimensionality reduction


Explore my site (designed and coded by me) to see my work experience and personal/academic projects demonstrating my skill set. Check out my GitHub to view the code for everything on this site, and visit me on CodinGame to see all the coding puzzles and challenges I have completed.

This site hosted on AWS Lightsail with an NGINX (LEMP) stack.

More About Me

  • Volunteer experience: preparing/serving meals at shelters and community outreach centers; working at music festivals and community events such as street fairs; and over a year of working for a small publishing company as a proofreader and copy-editor of novels
  • Other interests include:
    • Reading — science fiction, fantasy, horror, philosophy, history, science
    • Travel — have traveled extensively throughout Europe and North America
    • Art — writing, painting/drawing, music
    • Fitness — dedicated to nutrition and exercise as tools for health

Education


Master of Science (MS), Biomedical Informatics


  • In progress: 25 of 48 credit hours complete
  • 4.0 GPA
  • Completed courses in: bioinformatics, biostatistics, machine learning, epidemiology, research design

Ohio State University

Columbus, Ohio, USA

2025 - Present




Bachelor of Science (BS), Computing Science and Molecular Biology & Biochemistry (Joint Major)


  • Certificate in Genomics
  • Cooperative education
  • Graduated with Distinction: 3.8 GPA
  • Completed courses in: algorithms, artificial intelligence, statistics, databases; molecular biology, cell biology, genomics, organic chemistry

Simon Fraser University

Burnaby, British Columbia, Canada

2015 - 2020